Does beer make you blush? or, why “race” is a myth

Race is a word with an ugly history. Powerful countries have often used supposed differences between “races” as an excuse to conquer and enslave nations with technology less advanced than their own. In the 18th and 19th centuries, European scholars tried to disguise racism as science in order to justify exploitation and slavery. The eugenics movement of the early 20th century followed in their footsteps, and the Nazis likewise borrowed from 19th-century pseudoscience in their efforts to legitimize their deranged ideology.

With a history like this, it’s no surprise that among those who study human genetics, the word “race” still has the power to provoke controversy. Just last week, for example, the magazine American Scientist ran a review by Jan Sapp about two new books which argue race is a myth:

Although biologists and cultural anthropologists long supposed that human races—genetically distinct populations within the same species—have a true existence in nature, many social scientists and geneticists maintain today that there simply is no valid biological basis for the concept. The consensus among Western researchers today is that human races are sociocultural constructs.

Jerry Coyne, an evolutionary biologist at the University of Chicago, disagreed and said so:

Well, if that’s the consensus, I am an outlier.  I do think that human races exist in the sense that biologists apply the term to animals, though I don’t think the genetic differences between those races are profound, nor do I think there is a finite and easily delimitable number of human races.

It sounds a lot like a quibble over definitions — and in fact, that’s exactly what it is. But tempting as it is to dismiss it as mere semantics, it matters, because as history illustrates, words like these shape the way we see the world.

So does this concept we call “race” have any basis in reality? Or is it a myth?

If you asked the average American to explain what “race” means, they’d probably mention skin color, because skin color is the most obvious difference between human populations. There are of course some other physical differences too. One interesting example is ethanol.

If you’re Asian-American or have Asian-American friends/colleagues etc., you may have heard of or experienced the so-called “Asian flush” or “Asian glow”. It’s not unique to people of Asian descent by any means, but this swift rosy-cheeked reaction to even small amounts of ethanol is far more common among East Asians than among those of Caucasian descent. I’ve known folks who would flush red after drinking less than half a beer — which isn’t a lot of alcohol, at least not for me.

The origins of the “Asian flush” lie in the way your liver metabolizes ethanol. When you drink wine (or beer, or a Jack and coke, or a vodka Red Bull, or whatever), the ethanol is absorbed into your bloodstream through the lining of your small intestine and your liver gradually breaks it down through a two-step process. In the first step, ethanol is converted to acetaldehyde in a reaction catalyzed by an enzyme called alcohol dehydrogenase.

Ethanol is on the left, acetaldehyde on the right. Another molecule called NAD+ takes part in this reaction but I’ve omitted it here.

Acetaldehyde is significantly more toxic than ethanol; here in California, in fact, it’s classified as “a chemical known to the state of California to cause cancer”. To keep the State of California happy, your liver converts the acetaldehyde into acetate, just like the acetic acid in vinegar. This second reaction is catalyzed by enzymes called aldehyde dehydrogenases. The most important of these for our purposes is called ALDH2.

The gene for ALDH2 lies on chromosome 12 (the full sequence of the gene is here). About 4/5 of the way through the gene (position 42421 in the GenBank file at the link above) you have the following DNA sequence:

GAAGTGAAAACTGTGAGTGTGGGACCTGCTGGGGGCTCAGGGCCTGTTGGGGCTTGAG

In the ALDH2*1 version of the protein those first three letters — GAA — code for an amino acid called glutamate. In the “Asian flush” version of the gene (we’ll call it ALDH2-flush), a mutation has swapped out the G for an A, and the “AAA” triplet codes for an amino acid called lysine instead. The resulting enzyme is ineffective. If you inherit two copies of ALDH2-flush (one from each parent), your liver will still convert ethanol into acetaldehyde, but getting rid of the acetaldehyde is a slower process. After you drink, you temporarily end up with higher levels of acetaldehyde in your bloodstream — hence the flushed red face and other accompanying symptoms.

But it gets worse. The ALDH2 enzyme doesn’t work alone; 4 ALDH2 molecules clump together to form a single enzyme complex with four subunits*. Any time some of these subunits are ALDH2-flush, the resulting enzyme complex has reduced activity. So let’s say, for example, you inherit ALDH2*1 from your mom and ALDH2-flush from your dad. Now half of the ALDH2 protein produced in your liver cells is ALDH2*1, while the other half is ALDH2-flush. Most of the enzyme complexes that form will contain at least one ALDH2-flush subunit. Consequently, even if you inherit just one copy of the ALDH2-flush gene, the level of ALDH2 activity decreases by a much greater amount than you’d expect, given that you still have one “active” copy of the gene.

That’s why even people with just one copy of the ALDH2-flush variant still exhibit alcohol flush (albeit with less severe symptoms than those who have two copies). The young man in the “before-and-after” picture below, for example, inherited one copy of the ALDH2-flush gene. (This picture is from the PLoS article under [2]).

Now we come to the truly strange part of this story. ALDH2-flush is comparatively rare in European and African populations, but somewhere over a third of East Asians (Japan, Korea, China) have one or two copies of the ALDH2-flush gene, so through some bizarre quirk of our evolutionary history the “flush” variant of the gene has become fairly common in the East Asian population. And nobody really knows for sure why that might be.

Nor is this the only peculiarity of ethanol metabolism, because there are some interesting variations in other genes, most notably ADH1B. But I’ve wandered a little far off topic, so I’m going to come back around to this idea of different populations.

Clearly there are some interesting genetic differences between populations from different regions of the globe. Skin color, hair color and facial features are the most obvious, but there are others like ethanol metabolism and lactose intolerance too. So is it fair to call these different populations “races” on the basis of these genetic differences? Which is really another way to ask the question: what does the word “race” actually mean, anyway?

When I look up “race” in the Concise Oxford English Dictionary, I get the following not-very-concise definition:

1. Each of the major divisions of humankind, having distinct physical characteristics.

2. A group of people or things with a common feature.

3. A distinct population within a species; a subspecies.

The first definition is the one that’s been used historically, and I think it’s what most people have in mind when you say “race”. It’s a useless definition, because it assumes there are “major divisions” of humankind which are fundamentally different from each other, and that’s a completely incorrect assumption. The second definition is so vague it’s meaningless; by this definition, I could call candy bars a “race” because they contain sugar. And the third definition won’t work, because there is more genetic variation within these populations than between them. I like the way Jan Sapp puts it:

race is little more than skin deep in biological terms, and individuals are frequently more genetically similar to members of other so-called races than they are to their own said race.

So yes, there are interesting genetic differences between populations like skin color, hair color, ethanol metabolism and lactose intolerance, and ultimately the explanation for each of these lies in our evolutionary history. But while this genetic variation between human populations seems striking to us, it’s actually fairly trivial compared to the amount of genetic variation within human populations. These genetic differences are superficial and of relatively recent origin. And in the modern world, populations that were once kept relatively isolated from each other by geography are now mingling to an ever-increasing extent, such that the concept of “race” is becoming ever more meaningless.

You could of course define “race” another way. In his post, Jerry Coyne defines “race” thus:

In my own field of evolutionary biology, races of animals (also called “subspecies” or “ecotypes”) are morphologically distinguishable populations that live in allopatry (i.e. are geographically separated).  There is no firm criterion on how much morphological difference it takes to delimit a race.  Races of mice, for example, are described solely on the basis of difference in coat color, which could involve only one or two genes.

Coyne is right in a way. If you want to define “race” as a way to classify humans based on an arbitrarily-chosen morphological feature I suppose you could do that. But that makes nonsense of the word, because that’s not historically how race has been defined. Unless you redefine it to mean something it didn’t mean until now, I personally think the word “race” as applied to humans is basically meaningless (and loaded with a ton of ugly historical baggage into the bargain). If you want to describe a particular group, say people of East Asian ancestry, there’s no reason why you can’t use the word “population” instead.

We humans have a mania for categorizing things — classifying objects into discrete categories based on similarities and differences. It helps us to spot patterns and make sense of our world, so it’s often a useful habit. We have to be very careful, however, to make sure that the categories we use 1) are useful and 2) a reflection of the underlying reality.

A good example is the concept of species. If two organisms can mate and produce fertile offspring, we say they belong to the same species. But what about organisms that don’t reproduce sexually like bacteria? Pretty much any large population of bacteria will have some genetic diversity, and different populations of, say, E. coli could be genetically different from each other in lots of interesting ways. How different do they have to be from each other before you say, “These are now different species”? The problem here is that when it comes to bacteria, “species” is a category we invented, not a fundamental feature of the underlying reality. And Nature doesn’t care about our categories. The bacteria in a given population are what they are, regardless of how we categorize them. Nonetheless, we continue to classify bacteria into species because it’s a useful way for us to study them.

Similar considerations apply to the word “race” as applied to human populations. Does it reflect some fundamental underlying feature of reality? In the way it has conventionally been defined, no, it does not. Is it a useful categorization? No, not at all — in fact, throughout history this ill-defined, ridiculous concept has served as an excuse for exploitation and bloodshed. We are all members of the same subspecies, Homo sapiens sapiens. I agree with Sapp’s take: rather than redefining the word “race” in a futile effort to pretend it has some remaining utility, I think it’s high time we send the myth of “race” to its long-overdue end.

*i.e., a homotetramer.

[1] Nathalie Druesne-Pecollo, Bertrand Tehard, Yann Mallet, Mariette Gerber, Teresa Norat, Serge Hercberg, Paule Latino-Martel, Alcohol and genetic polymorphisms: effect on risk of alcohol-related cancer, The Lancet Oncology, Volume 10, Issue 2, February 2009, Pages 173-180, ISSN 1470-2045, 10.1016/S1470-2045(09)70019-1.

[2] Brooks PJ, Enoch MA, Goldman D, Li TK, & Yokoyama A (2009). The alcohol flushing response: an unrecognized risk factor for esophageal cancer from alcohol consumption. PLoS medicine, 6 (3) PMID: 19320537

26 thoughts on “Does beer make you blush? or, why “race” is a myth

  1. Nice post. One point: notions like subspecies and race have been loaded, largely in the past century or so, with heavy connotations of discreteness and geographical structure that they did not before around 1860. For a biologist, race or subspecies simply meant, as Darwin so succinctly put it, a well-marked variety in a species (of plant, animal or fungus). There was no requirement every species had subspecies, nor was there much weight put on it except by those, like Agassiz, who were in fact cultural racists.

    That there is population structure in species was widely held and understood, and the rest was a matter of conventional distinctions for economic (breeders’ and vendors’) or subjective reasons. I think that the terms have been given such weight simply because of the role they played in the imperial era socially, and in particular how they are used in American discourse.

    That said, I disagree (and have a book and a few papers to argue the case) that “species” is invented. Species are discovered. What was invented is the category, or rather the theoretical definition of that category by various biologists touting their preferred accounts. But species are no more invented than a mountain peak or a river.

    • Thanks. I think that to some degree it’s not really possible to redefine the word and separate it from its connotations. At the end of the day, it’s really not a useful concept. There are plenty of other more useful words/concepts (e.g. population).

      And yes, I agree, the species concept works well for the most part where plants, animals etc. are concerned. But when you’re talking about bacteria, it’s a lot less clear what we mean by “species”. Consider the case of Salmonella. Originally it was defined as one serotype = one species; today, however, Salmonella bacteria are classified into two species; one of them, S. enterica, is classified into six subspecies, and from thence into over two thousand serotypes. Often when people talk about Salmonella bacteria involved in specific outbreaks, they will say, for example, S. typhi or S. typhiumurium as if these were actually species names, but in fact they are serotype names. The whole business illustrates the somewhat arbitrary nature of “species” as applied to bacteria. And then there is the question of horizontal gene transfer between taxa that are not closely related.

  2. Nice! I totally agree with you.. and in fact two bacteria are of the same species if they share at least 30% of their genome.
    And another comment that works as an argument for you, is that human populations are constantly migrating and breeding between populations, so there is no allopatry; there is no punctuated separate populations, instead there are gradual physical changes between all humans.

  3. Pingback: Books & Climate Change | Pearltrees

  4. Great post, and considerably more thoughtful than most on this topic.
    However I do disagree with your conclusion that racial classification is not “useful” in any sense.
    In my opinion the word “race” carries a meaning as a useful shorthand for a collection of traits unique to that race, in effect functioning the same way as signifiers like blue eyes, epicanthic folds or left handedness et cetera.
    It may not be strictly useful per se, but it is nonetheless true that you can identify a specific collection of genetic hereditary features that exists within a group or subdivision of humanity, and since it is then an actual mode of classification, it is useful in itself.
    After all, science is nothing but the ever finer atomisation of the world. Could we practically sequence the full DNA of every human on Earth we would end up some seven billion sub-races, but since we cannot, it carries meaning to speak of race as a shorthand for some defined traits within humanity as a whole. We cannot, in my opinion, let previous erroneous thoughts about race and racism that has no basis in reality stop us from certain modes of scientifically valid classification.
    Indeed, ultimately, science is important, people are not.

  5. Racism wasn’t really a preoccupation of 18th-century scholars; it became popular in the early 1800s. For most of the African slave trade period, slave-trading was justified in nonbiological terms.

    • Good point. To take one example, I know that Carolus Linnaeus, in his classification system in the mid 18th century, divided humankind into what were clearly racial groups and attributed stereotypical attributes to each. So while it may not have been a preoccupation of 18th-century scholars, but the roots of scientific racism seem to extend all the way back into the 18th.

      • The roots of race theory (I’m going by Arendt here; I’m not a scholar of this) start with the attempt in the 1700s (late 1600s?) of parts of the French aristocracy to justify their position relative to the rising power of the king and middle class by appealing to their Germanic Frank heritage, which supposedly made them superior to the Gaulic/Roman masses. But it doesn’t really become popular until much later, in the early 1800s. Prior to that African slavery was usually justified by arguing that Africans were in a primitive state and had to be tutored (by slave masters) in the ways of civilization and religion before they couls, at some point in the future, rise to the level of Europeans. An idea that makes no sense to somebody who thinks that there are unalterable racial differences. Again according to Arendt, this was one of the points of conflict between the British and the Boers, because the Brits viewed the natives as backward, childlike human beings and the Boers viewed than as an essetntially different kind of animal.

  6. What about the findings of genetic contributions from other hominins in different populations(Neanderthal DNA in non-Africans, Denisovan DNA in some Melanesians and Aborigines)? Do these data at all affect the issue of “race”? In other words, is any of the DNA from these other hominins significant, or is it just junk DNA? I think this issue needs to be very clear, lest more ignorant/hateful individuals cling onto this information to support their views.

  7. Pingback: Does beer make you blush? or, why “race” is a myth | Puff the Mutant Dragon « linkstream2

  8. Race was almost always a culturally derived word. It is absurd to try and apply taxonomic principals to try and create a term that works for race like sub species. That is a strictly scientific invention being overlayed onto a culturally morphic word. By its very historical cultural fluidity it proves itself to not be a scientific term. Usually or archetypically used as a term to define ones country “British race” German race etc…it was clear that history did not bear out cultural or historical purity. The nationalistic terminology then adapted itself to the basist of references, skin colour, the big 4 black yellow white red…well of course this breaks down to absurdity…and with mongoloid, negroid etc…there are less and less culturally legitimate ways for humans to divide themselves. Divisions of race were always about power structures not science…get rid of it, it by its nature, and semiology is unto itself a racist term. We can still identify eachother as different culturally without resorting to arcane terms of violence and oppression, or worse trying to validate them scientifically.

  9. Nice article! Isn’t this why we came up with the concept of biogeographical ancestry though? To just drop the word ‘race’ with all it’s baggage, and yet still do relevant research (into stuff like variations in the CYP2D6 gene, it’s abscence in up to 10% of Caucasians means codeine has no effect there, while that number in Asians is less than one percent, and in Ethiopians there is a generally higher level of CYP2D6 which could cause excessive sedation for a ‘normal’ dose). That kind of variation in how drugs work is everywhere, and until we get our 10€ sequencers and customised medicine, it’s the kind of research that is needed in medicine.

    • Exactly. It’s not that these genetic variations aren’t interesting or potentially useful in medicine — they are. I just don’t think the concept of “race” with all its attendant baggage is useful.

    • As an addition to my earlier note — one caveat on the same subject Categorizing people into “races” based on self-identification is a very naive way to study disease genetics — another illustration that race as it has traditionally been defined is not a useful concept. There is substantial variation within each of these populations, and someone’s “race” is in most cases not going to be a reliable predictor.

      • I will just skip the ‘categorisation of people into races’ part, it’s obsolete in science. The word itself is dead, and when I do see a paper (e.g. http://www.ncbi.nlm.nih.gov/pubmed/18826856) using the word it seems crass.

        And you are completely right when you say “”someone’s “race” is in most cases not going to be a reliable predictor””. In most cases. In many many cases, it can be a strong indicator. Think about the BRCA2 mutations causing breast cancer. There is *one single* mutation in Iceland that is responsible for all cases of breast cancer on that island. Knowing the ancestry of a person with breast cancer in that case is hugely indicative. There is a series of mutations specific to different BGAs for BRCA2 and they are totally reliable predicators.

        The LRRK2 gene for Parkinsons is another example. And Tay Sachs disease is a great and fascinating example for both sides of the argument, the mutation was originally thought to have a founder in Ashkenazi Jews, and the hypothesis in the 60s was that a member of that population had spread the disease to one of the only other populations that also are predisposed to TSD, French Canadians. However sequencing showed the mutations to be dissimilar. However TSD is so completely isolated to these two populations (and a population of Cajuns in Louisiana irc), that it’s the perfect example of your biogeographical ancestry being relevant as a potential indicator for predisposition to certain diseases. There’s a reason the Ashkenazi Jews are so well studied, it’s because they are a beautiful example of the reliably distinct disease characteristics of a single biogeographical ancestry.

        There are literally thousands of studies every year on geographically isolated, ethnically indigenous/homogenous peoples, looking at a multitude of factors in health and disease. Sicily, Iceland, Ireland, Finland, Japan, they are all ideal examples of geographically isolated people that share a common gene pool. And yes, it’s not reliable, there are massive variations, and there always has been immigration and emigration, and there are de novo point mutations and rearrangements, and on top of that we’re talking about genes that might have weak affects, masked by environmental factors. That’s why we have P-values and standard deviations and that’s why (hopefully), we can avoid throwing the baby out with the bathwater and use these probable indicators well in medicine.

        Just as much as you should get checked often for breast cancer if you have a history of it, so if you are of Mediterranean descent you should know about thalassemia. The idea is absolutely identical. For the example you write about, ALDH2-flush, those people with a BGA that is linked to ALDH2-flush have a corresponding higher risk for esophageal cancer.

        Using BGA as a ‘shortcut’ to diagnosis might seem sloppy, but in science and medicine it happens every day. If you come into an ER with complaining of chest tightness and a stabbing pain down your arm, and you look aged and a little obese, the doctor might think of a heart attack. If you come in smelling of alcohol and have slurred speech and trouble focusing, he might think you are drunk. It **might** be right, in most cases it probably is right. It could also be that you got hit by a bottle of vodka in the head explaining the smell, and you have suffered a concussion, explaining the speech. It’s a game of statistics and probability.

        And if I could sum up disease genetics in a single sentence, it would be “it’s a game of statistics and probability”.

        —–
        (Here is a good link that has an interesting counterpoint to your blog post! http://www.scq.ubc.ca/the-finnish-disease-heritage-and-other-genetic-isolates/ )

        Also Biotech represent! I too have a biotech background🙂

      • I agree the term “race” is obsolete; in fact, that was the whole point I wanted to make. The racial categories to which people have traditionally been assigned by our culture (“Black”, Hispanic, Caucasian, etc.) are crude catchall categories defined by social attitudes and perceptions, and I don’t think they are especially relevant or useful to medicine. So I think we should junk the term “race”, and I think that we have in science for the most part, but the term and its associations are still a part of our popular culture. It may be part of the way the media explains (or does not explain!) the issue to the public. But leaving the cultural problem aside, genetic variations like the ones you mention (or like the ALDH2 and ADH1B polymorphisms) are fascinating and in some cases have medical relevance — I completely agree on that score!

  10. Pingback: Why [Once Again] Race Is Irrelevant…Post For The Scientifically Inclined « Integrated Memoirs

  11. Pingback: Race, racist judges, defamation, quantum taxes and death…. « blueollie

  12. “While this genetic variation between human populations seems striking to us, it’s actually fairly trivial compared to the amount of genetic variation within human populations.”

    This easily leads to Lewontin’s Fallacy, which I was disappointed to find no mention of in your post: http://en.wikipedia.org/wiki/Race_and_genetics#Lewontin.27s_argument_and_criticism

    Unless I’ve missed something in the literature, race _can_ be distinguished genetically in a meaningful way as long as you measure more than 1 trait at a time. It is not a “myth,” even if it is difficult to define, and perhaps a more specialized word should be used in genetics.

    • “”It is not a “myth,” even if it is difficult to define, and perhaps a more specialized word should be used in genetics.””

      I think it’s a complex issue, but as a geneticist I think it’s a little like this…

      In the brain there are neuronal cells, and as they migrate away from the layers where they are formed by progenitor cells, they undergo various types of differentiation. And when you study them, you can classify these groups by looking at certain receptors they express. CD34 positive cells, CD 8 positive cells, and so on. If you then look at a slide of brain tissue, you can see a nice layer of red cells that are CD XX+, and then a cleanly separated layer of green cells that are CD ZZ+, and then maybe another blue layer for some other marker.

      The same in skin, you can look at skin cells as they migrate upwards from the basal layer, and they express different Keratins as they go, changing from K5 positive to K1 and K10 positive cells.

      The problem is this is relatively arbitrary. In the brain, those neurones express *many* different receptors. You can look closer and closer, with a finer and finer lens, constantly differentiating new groups that have a different matrix of antigens than their sister cells. Why were they divided by this particular set of markers then? It was convenient, a helpful tool to grasp the concepts of different neurones at all.

      And it’s time is passing by, today the full massively complex matrix of different neurones is being mapped out, and it’s an incredibly complex task.

      For people, the equivalent set of alleles that we can attribute our historical idea of race to, is as arbitrary, and as obsolete. These are useful data in knowing about those alleles, but not *just* those alleles. Once the personalised genome arrives (surely within a decade, judging by the way prices are bottoming out), the full matrix of human genomic diversity will be realised, and the archaic idea of race will be as obsolete and forgotten as Betamax.

      • Thanks — the neuron analogy really works for me🙂. And I think it provides a healthy way to think about the intra-population vs. inter-population genetic diversity.

        I guess I was mostly just reacting to the tendency of people to say race is a “biologically meaningless” concept (as I saw it presented at the Smithsonian Museum of Natural History a few months ago) which strikes me as a piece of rhetoric that’s not quite true.

        But that’s really a side point. Thanks for brining me back to the big picture.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s